استفاده از Multiplex PCR جهت تشخیص کوکسی های گرم مثبت ایجاد کننده بیماری در مزارع پرورشی قزل آلای رنگین کمان(Oncorhynchus mykiss), ایلام

نوع مقاله: علمی پژوهشی

نویسنده

دانشکده دامپزشکی شهید چمران اهواز

چکیده

در پنج سال اخیر بیماری مشکوک به streptococosisدر مزارع پرورشی قزل آلای رنگین کمان شهر ایلام به صورت اپیدمی شایع شد. در مطالعه حاضر، 60 قطعه ماهی با علائم بالینی نظیر بی حالی، شنای نامنظم، تیرگی پوست و اگزوفتالمی، از مزارع پرورش قزل آلای رنگین کمان ایلام(جنوب غربی ایران) جمع آوری شد. جهت تشخیص عامل اصلی بیماری، نمونه‌هایی از کبد، کلیه و طحال برداشته و در محیط کشت آگار خوندار ( blood agar) در دمای 22 درجه سانتی‌گراد به مدت 24 ساعت انکوبه شد. بر اساس تست های بیوشیمیایی نمونه های جدا شده Lactococcus garvieae شناسایی شدند جهت تایید ایزوله‌ها از multiplex PCR و ژن‌های lctO ، 16S rRNA و 16S- 23S rRNA که به ترتیب جهت شناسایی Lactococcus garvieae, Streptococcus iniae و Streptococcus dysgalactiae به کار می رود استفاده شد. در این مطالعه برای غالب ایزوله‌ها باندی به طول bp 1100 تشکیل شد که مربوط به باکتری L. garvieae می باشد. بر این اساس می توان نتیجه گرفت که عامل اصلی بروز سپتی سمی L. garvieaeبوده است. در نتیجه Multiplex PCR روش تشخیصی قطعی جهت شناسایی سریع باکتری به ویژه در عفونت های ترکیبی می باشد.

کلیدواژه‌ها


صنعت آبزی پروری، به طور اجتناب ناپذیری پرورش ماهی را در شرایط متراکم به همراه دارد و به موازات چنین شرایطی، سلامت آبزیان به خطر افتاده و انتشار بیماری­های عفونی در بین جمعیت های آبزیان به سهولت بیشتری انجام می پذیرد. در سالهای اخیر، صنعت آبزی پروری در ایران با مشکل شیوع بیماری های باکتریایی به ویژه streptococcosis مواجه شده است. باکتری های بیماری زا در ماهی به دو گروه گرم مثبت و گرم منفی تقسیم می شوند بر اساس مطالعات تاکسونومیک شش گونه باکتری گرم مثبت سبب ایجاد بیماری در ماهی می شوند که عبارتند از :Streptococcus parauberis (Domenech et al., 1996), Streptococcus iniae (Eldar et al., 1995), Streptococcus difficillise (Eldar et al., 1994), Lactococcus piscium (Williams et al., 1990), Vagococcus salmoninarum (Michel et al., 1997),  و Lactococcus garviea (Eldar et al., 1996)

Lactococcus garviea کوکسی گرم مثبتی است که به عنوان عامل اصلی بیماری لاکتوکوکوزیس در گونه های مختلف ماهی در سراسر جهان هنگامی که دمای آب به بالاتر از ºC 16 برسد گزارش شده است(Vendrell et al., 2007;Vendrell et al., 2006; Barnes et al., 2002) لاکتوکوکوزیس بیماری اصلی شایع در مزارع پرورشی قزل آلای رنگین کمان (Oncorhynchus mykiss)  در تعدادزیادی از کشورها مانند ایتالیا(Ghittino and Prearo., 1992)، استرالیا و آفریقای جنوبی(Carson et al., 1993)، انگلستان(Barak and Mc Gregor, 2001)، پرتغال(Pereira et al., 2004)، فرانسه(Eyngor et al., 2004) و ترکیه Kav and Evganis., 2008)  ) بوده و سبب بروز خسارات فراوان اقتصادی به مزارع پرورشی قزل آلای رنگین کمان از سال 1970شده است (Lincoln and Glasscock., 2001). در ایران این بیماری برای اولین بار در قزل آلای رنگین کمان در استان مازندران، در شمال ایران در سال 1999گزارش گردید (Ghiasi et al.,2000),  پس از آن به صورت پراکنده در استان فارس، در جنوب ایران گزارش گردید(Akhlagi and Mahjor, 2004)..

اخیراً روش های تشخیصی مولکولی مانند واکنش زنجیره ای پلی مراز (PCR) برای شناسایی تعدادزیادی از باکتری های بیماری زا در ماهی مانندYersinia ruckeri, Pseudomonas anguilliseptica, L. garvieae, Renibacterium salmoninarum and Aeromonas salmonicida (Gustafson et al., 1992; Miriam et al., 1997; Gibello et al., 1999; Aoki et al., 2000; Blanco et al., 2002)

استفاده می شود. Multiplex PCR یکی از اصلی ترین و مفید ترین روش های شناسایی باکتری های بیماری زا در ماهیان می باشد(Edwards and Gibbs, 1994). این روش جهت تشخیص سریع پاتوژن های  ماهی بخصوص استرپتوکوک های آب گرم (Mata et al., 2004b) و نیز سه پاتوژن دیگر ماهی A. salmonicida, Flavobacterium  psychrophilum and Y. ruckeri  (Del Cerro et al., 2002) استفاده شده است. از سال 2006، بیماری با علائم کلینیکی مشابه با استرپتوکوکزیس، شامل: شنای نامنظم، تیرگی پوست، اگزوفتالمی و خونریزی در پوست در مزارع پرورشی قزل آلای رنگین کمان  توسط اداره دامپزشکی استان ایلام، گزارش گردید. هدف از مطالعه حاضر، جداسازی و شناسایی عامل اصلی بیماری درمزارع پرورشی قزل آلایرنگین کمان در استان ایلام با استفاده از multiplex PCR می باشد.

مواد و روش ها:

1-     نمونه برداری و کشت باکتری

جهت انجام تحقیق حاضر، 60 قطعه ماهی (میانگین وزنی 23±47/141 گرم و میانگین طول کل 63 ±07/20 سانتی متر) به طور تصادفی از میان ماهیان دارای نشانه­های بالینی بیماری (اگزوفتالمی، هموراژی در باله ،اتساع شکم و....) و نیز 10 قطعه ماهی قزل­آلای رنگین کمان فاقد علائم کلینیکی بیماری به عنوان شاهد (دارای میانگین وزن و طول مشابه ماهیان بیمار)، از 5 مزرعه پرورشی ماهی قزل­آلای رنگین کمان واقع در اطراف شهر ایلام با سابقه گزارش بیماری و مرگ ومیر ماهی،  در بهمن ماه 1388، جمع آوری شد. پس از انتقال ماهیان به آزمایشگاه و بیهوش نمودن آنها توسط عصاره گل میخک، در شرایط کاملاً استریل نمونه­هایی جهت کشت باکتری از کبد، کلیه و طحال برداشته و به اولین محیط کشت مغذی یعنی محیط کشت مایع تریپتون سوی (TSB)منتقل و در دمای 25 درجه سانتی­گراد به مدت24 - 18 ساعت انکوبه شدند. پس از رشد باکتری ها در محیط (TSB)، نمونه ها  روی محیط کشت آگار خوندار (حاوی 5 درصد خون گوسفند) کشت و در دمای22 درجه سانتی­گراد به مدت 18 تا 24 ساعت انکوبه شدند.(Vendrell et al., 2007)

2-    شناسایی باکتری

2-1- مورفولوژی کلنی باکتری

جهت شناسایی اولیه، باکتری ها تحت رنگ آمیزی گرم و تست های بیوشیمیایی نظیر کاتالاز و اکسیداز قرار گرفتند.

2-2- مطالعات ژنتیکی

   DNA باکتری های خالص بدست آمده با استفاده از روش جوشاندن استخراج شد (Holmes and Quigley, 1992)

به این ترتیب که120 - 100 میکرولیتر از محلول بافر تریسEDTA [1] برداشته و چند کلنی باکتری با آن مخلوط کرده و سپس میکروتیوب­ها در دستگاه  Comfort eppendorf Thermomixer که در دمای 99 درجه سانتی­گراد تنظیم شده بود ، به مدت 10دقیقه جوشانده شدند. پس از گذشت 10دقیقه میکروتیوب­ها با دور rcf 13000 و به مدت 2 دقیقه سانتریفیوژ (Centrifuge 5415D eppendorf)شدند. جهت انجام واکنش زنجیره ای پلی مراز(PCR) ، 4 میکرولیتر مسترمیکس (ساخت شرکت سیناژن)، 6 میکرولیتر پرایمر با غلظت 10 پیکومول (برای هرگونه باکتری یک زوج پرایمر) و 3 میکرولیتر از DNA استخراج شده از باکتری ها درون میکروتیوب­های 200 میکرولیتری اضافه شد و حجم محلول توسط آب مقطر دو بار تقطیر تا حجم 20 میکرولیتر افزایش یافت. سپس میکروتیوب­ها در دستگاه Mastercycler gradient thermal Cycler (ساخت شرکت اپندورف)  قرار داده شدند و آزمایش PCR طبق  روش زیر صورت گرفت:

الف. دناتوره کردن اولیه[2] در دمای 94 درجه سانتی گراد به مدت 5 دقیقه

ب. دناتوره کردن نهایی (ثانویه[3])  شامل 30 چرخه در دمای 94 درجه سانتی­گراد، هر یک به مدت 1 دقیقه

ج. اتصال (آنیلینگ[4]) در دمای50  درجه به مدت 1 دقیقه

د.  امتداد[5] در دمای 72 درجه به مدت 1 دقیقه

پس از اتمام PCRمحصولات pcr بر روی ژل آگاروز 1درصد الکتروفورز گردید و پس از رنگ آمیزی با اتیدیوم برماید و عکس برداری مورد مطالعه قرار گرفت.

جدول 2-1. مشخصات پرایمرهای مورد استفاده در Multiplex PCR

Primer pairs

Sequence (5´to 3´)

Target gene

PCR amplicon(pb)

Pathogen

Reference

plG-1   

CATAACAATGAGAATCGC

16SrRNA

1100

L. garvieae

Zoltkin et al (1998)

plG-2     

GCACCCTCGCGGGTTG

       

Lox-1   

AAGGGGAAATCGCAAGTGCC

lctO

870

S. iniae

Mata et al (2004b)

Lox-2    

ATATCTGATTGGGCCGTCTAA

       

STRD-DYI  

TGGAACACGTTAGGGTCG

16S-23SrRNA

259

S.dysgalactia  subsp

Hassan et al(2003)

Dys-16S-23S-2

CTTAACTAGAAAAACTCTTGATTATTC

   

dysagalactia

 

 

نتایج

-       مطالعات مورفولوژیک و بیوشیمیایی

تمام باکتری های جدا شده از کبد، کلیه و طحال کوکسی گرم مثبت بوده که پس از کشت بر روی محیط کشت آگار خوندار(blood agar) کلنی هایی خاکستری دارای همولیز آلفا بودند. KOH و اکسیداز و کاتالاز مثبت، سدیم سیترات، H2S، نیترات و اوره منفی بوده و بر پایه ی این نتایج بیوشیمیایی باکتری L. garvieae شناسایی گردید.

نتایج pcr

از 156 نمونه باکتری جداشده از ماهیان بیمار 88 مورد  پس از انجام mpcr باندهایی به طول  bp1100 تشکیل دادند(Mata et al., 2004b)

 

شکل 1. الکتروفورز محصول   mPCR، DNA استخراج شده باکتری و پرایمرها. ستون1  از سمت چپ: DNA سایز مارکر به طول مضربی از bp 100، ستون 2 :کنترل منفی، ستون 3: کنترل مثبت (لاکتوکوکوس گارویه (A170) را نشان می دهد. تمامی ستون­ها ایزوله­هایی هستند که با پرایمر ها تشکیل باند داده ودر bp1100 باند اختصاصی لاکتوکوکوس گارویه را تشکیل دادند(باند تشکیل شده در ستون 13 ضعیف تر از بقیه می باشد).

بحث

لاکتوکوکوزیس سبب بروز سپتی سمی خونریزی دهنده در ماهیان می شود(Bercovier et al., 1997). این بیماری سبب بروز خسارات اقتصادی فراوان درمزارع پرورشی قزل آلا در کشورهای اروپایی و کشورهای حاشیه دریای مدیترانه  شده است(Ravelo et al., 2003). علائم کلینیکی لاکتوکوکوزیس مشاهده شده در قزل آلا ی رنگین کمان مشابه علائم گزارش شده در گونه های دیگر ماهیان می باشد(Chen et al., 2002). برای نخستین بار Lactococcus garvieae به عنوان عامل پاتوژن ماهی در اروپا گزارش شد(Palacios et al., 1993)  و نیز برای اولین بار در سال 1995 در مزارع پرورشی قزل آلای رنگین کمان در ترکیه این باکتری جداسازی شد(Cagirgan and Tanrikul, 1995) در مطالعه حاضر نتایج حاصل از تست­های بیوشیمیایی باکتری­های جدا شده از ماهیان بیمار با نتایج گزارش شده توسط محققان دیگر (Austin and Austin, 2007; Soltani et al., 2008; Sharifiyazdi et al., 2010) هماهنگی دارد. تمایز و شناسایی باکتری های L. garviae, S. iniae, S. dysgalactiae از یکدیگر تنها بر پایه ی تست های  بیوشیمیایی، بسیار وقت گیر  بوده و در ضمن نتایج بدست آمده قابل اطمینان نیستند بنابراین به اندازه کافی برای تشخیص بیماری در مزارع پرورشی مفید نبوده  و از نظر اقتصادی به صرفه نیست. در ضمن هر گونه تأخیر در تشخیص عامل بیماری زا در مزارع پرورشی می تواند سبب بروز خسارات اقتصادی فراوان شود.

امروزه لاکتوکوزیس یک عفونت شایع در قزل آلای رنگین کمان در کشورهای مختلف از جمله  ایران محسوب می شود. PCR یک روش  سریع و کاربردی در شناسایی پاتوژن های ماهی می باشد(Sharifiyazdi et al., 2010). آزمون multiplex PCR یک روش مفید است که امروزه برای تشخیص عفونت های مختلف در پزشکی و دامپزشکی به کار می رود(Nomoto et al., 2004). روش m-PCR جهت شناسایی Aeromonassalmonicida، Yersinia rockeriو Flavobacteriumpsychrophilum در سال 2002 توسط del Cerro و همکاران پایه گذاری شد و اخیراً multiplex PCR برای شناسایی گونه Vibrio به کار گرفته شد(Espineira et al., 2010).

پیش از این Zoltkin و همکاران در سال 1998 با استفاده از پرایمر های PLG1 و PLG2 و ژن 16s rRNA باکتری L. garvieae را از میان باکتری های جداسازی شده از قزل آلای رنگین کمان مزارع پرورشی آسیا و اروپا و استرالیا شناسایی کرده و گزارش دادند که باکتری ذکر شده باندهایی به طول bp 1100 را تولید می کند.

در مطالعه حاضر نتایج فنوتیپی توسط مطالعات مولکولی(m-PCR) تأیید گردید. در تحقیق حاضر جهت انجام m-pcr از توالی ژن های ذکر شده در جدول 1 جهت شناسایی L. garviae, S. iniae, S. dysgalactiae که باندهایی به طول 1100، 870 وbp 256 را تولید می کنند، استفاده شد. این نتایج با نتایج گزارش شده توسط Zlotkin و همکاران (1998) برایL. garvieae ، Mata و همکاران (a2004) برایS. iniae  وHassan و همکاران (2003) برایS. dysgalactiae  که همگی از single PCR جهت شناسایی باکتری­های ذکر شده استفاده کرده بودند، مطابقت داشت. بر اساس داده های حاصل و برپایه ی نتایج تست های بیوشیمیایی و مولکولی، عامل اصلی ایجاد کننده بیماری در مزارع پرورشی قزل آلای رنگین کمان که تاکنون استرپتوکوکوزیس گفته می شد، لاکتوکوکوزیس و عامل اصلی ایجاد کننده بیماری باکتری L. garvieae شناسایی شد. . در نهایت، نتایج تحقیق حاضر  نشان می دهد که m-PCR روش تشخیصی مفیدی جهت شناسایی همزمان عوامل اصلی بیماری در عفونت های متفاوت باکتریایی است و یک روش کار آمد برای شناسایی L. garvieae در ماهی بیمارو یک روش مفید در مطالعات اپیدمیولوژیک می باشد.

 

منابع:

 

Akhlaghi, M. and Mahjor, A. A., 2004. Some histopathological aspects of streptococcosis in cultured rainbowtrout (Oncorhynchus mykiss). Bulletin of European Association of Fish Pathologists, 24, 132-136

Austin, B. and Austin, D. A., 2007. Bacterial fish pathogens, diseases of farmed and wild fish. 2nd Ed. Chichester. UK: Springer Praxis Publishing. P. 552

 

Aoki, T., Park, C. I., Yamashita, H. and Hirono, I., 2000. Species-specific polymerase chain reaction primers for Lactococcus garvieae. Journal of Fish Disease, 23, 1–6

 

Barnes, A. C., Guyot, C., Hanse, B. G., Mackenzie, K., Horn, M.T., Ellis, A. E., 2002.  Resistance to serum killing may contribute todifferences in the abilities of capsulate and non-capsulated isolates of Lactococcus garvieae to cause disease in rainbow trout (Oncorhynchus mykiss L.). Fish Shellfish Immunology, 12, 155-168.

 

Bark, S.  and Gregor, D. Mc., 2001. The first occurrence of lactococcosis in farmed trout in England. Trout News, 31, 9–11.

 

Bercovier, H., Ghittino, C. and Eldar, A., 1997. Immunization with bacterial antigens: infection with streptococci and related organisms. Developments Biological Standardization, 90, 153-160.

 

Blanco, M. M., Gibello, A., Vela, A. I., Moreno, M. A., Domínguez, L. and Fernández-Garayzabal, J. F., 2002. Winter Disease outbreak in sea bream (Sparus aurata) associated with Pseudomonas anguilliseptica infection. Diseases of Aquatic Organisms, 50, 19–27.

 

Carson, J., Gudkovs, N. and Austin, B., 1993. Characteristics of an Enterococcus-like bacterium from Australia and South Africa pathogenic for rainbow trout (Oncorhynchus mykiss Walbaum). Journal of Fish Disease, 6, 381-388

 

Caghrgan, H. and Tanrhkul, T., 1995. A new problem for turkish rainbow trout (Oncorhynchus mykiss, W.) farms: Enterococcus like bacterium infection. Bornova Vet Kont ve Araşt Enst Müd Derg, 19 (33),  9-19.

 

Chen, S. C.,  Liaw, L. L., Su,  H. Y., Ko,  S. C., Wu, C. Y.,  Chaung, H. C., Tsai, Y. H., Yang, K. L., Chen,  Y. C., Chen, T. H., Lin, G. R., Cheng, S. Y.,  Lin,  Y. D.,  Lee,  J. L., Lai,  C. C.,  Del Cerro, A., Marquez, I., Guijarro, J. A., 2002. Simultaneous detection of Aeromonas salmonicida, Flavobacterium psychrophilum, and Yersinia ruckeri, three major fish pathogens, by multiplex PCR. Applied and Environmental Microbiology, 68, 5177–5180.

 

Domenech, A., Fernandez-Garayzabal, J. F., Pascual, C., Garcia, J. A., Cutuli, M. T., Moreno, M. A., Collins,  M. D. and Dominguez, L., 1996. Streptococcosis in cultured turbot, Scophthalmus maximus (L.), associated with Streptococcus parauberis. Journal of Fish Disease, 19, 33–38.

 

Edwards, M. C. and Gibbs, R. A., 1994. Multiplex PCR: advantages, development, and applications. PCR Methods Applied, 3, S65– S75.

 

Eldar, A., Bejerano, Y. and Bercovier, H., 1994. Streptococcus shiloi and Streptococcus difficile: two new streptococcal species causing a meningoencephalitis in fish. Current Microbiology, 28, 139–143.

 

Eldar, A., Frelier, P. F., Assenta, L., Varner, P. W., Lawhon, S.  and Bercovier, H., 1995. Streptococcus shiloi, the name for an agent causing septicemic infection in fish, is a junior synonym of Streptococcus iniae. International Journal of Systematic Bacteriology, 45, 840–842.

 

Eldar, A., Ghittino, C., Asanta, L., Bozzetta, E., Goria, M., Prearo, M. and Bercovier, H., 1996. Enterococcus seriolicida is a junior synonym of Lactococcus garvieae, a causative agent of septicemia and meningoencephalitis in fish. Current Microbiology, 32, 85–88.

 

Espineira, M., Atanassora, M., Vieites, J., M. and Santaclara, F. J., 2010. Validation of a method for the detection of five species, serogroup, biotypes and Virulence factor of Vibrio by multiplex PCR in fish and seafood. Food Microbiology, 27, 122-131.

 

Eyngor, M., Zlotkin, A., Ghittino,C., Prearo, M., Douet, D-G., Chilmonczyk, S. and Eldar, A., 2004. Clonality and Diversity of the Fish Pathogen Lactococcus garvieae in Mediterranean Countries. American Society for Microbiology, 70(9), 5132-5137.

 

Ghiasi, M., Zahedi, A. and Rostami, H., 2000. The occurrence of streptococcosis in rainbow trout broodstock in Mazenderan province, north of Iran. Proceeding of the 1st Aquatic Animal Health Conference. Ahwaz. Iran.

 

Ghittno, C . and Prearo, M., 1992.  Reported of Streptococcosis in rainbow trout(Oncorrynchus mykiss)in Italy: preliminary  not. Boll Soc it patol Ittica, 8, 4-1.

Gustafson, C. E., Thomas, C. J. and Trust, T., 1992. Detection of Aeromonas salmonicida from fish by using polymerase chain reaction amplification of the virulence surface array protein gene.  Applied and Environmental Microbiology, 58, 3816–3825.

 

Gibello, A., Blanco, M. M., Moreno, M. A., Cutuli, M. T., Domenech, A., Domínguez, L. and Fernandez-Garayzabal, J. F., 1999. Development of a PCR assay for detection of Yersinia ruckeri in tissues of inoculated and naturally infected trout. Applied and Environmental Microbiology, 65, 346–350.

 

Hassan, A. A., Khan, I. U. and Lammler, C., 2003. Identification of Streptococcus dysgalactiae strains of Lancefield,s group C, G and L by polymerase chain reaction. Journal of Veterinary Medical Biology 50, 161-165.

Holmes, D. S. and Quigley, M., 1992.  Arapid boiling method for the preparation of bacterial plasmids. Annual Review of Biochemistry, 114, 193-197.

Kav, K. and Evganis, O., 2008. Antibiotic susceptibility of Lactococcus garvieae in rainbow trout(Oncorhyncus mykiss)farms. Bulletin of the Veterinary Institute in Pulawy, 52, 223-226.

Lincoln, D. and Glasscock, D., 2001. Trout News. Center for environment, fisheries and aquaculture science. page 9.

Mata, A. I., Blanco, M. M., Dominguez, L., Fernandez-Garayzabal, J. F. and Gibello, A., 2004a. Development of PCR assay for Streptococcus iniae based on the lactate oxidase (lctO) gene with potential diagnostic value. Veterinary Microbiology, 101, 109-116.

Mata, A. I., Gibello, A., Casamayor, A., Blanco, M. M., Dominguez, L. and Fernandez-Garayzabal, J. F., 2004b. Multiplex PCR assay for detection of bacteria pathogens associated with warm-water Streptococcosis in fish. Applied and Environmental Microbiology, 70, 3183-3187.

Miriam, A., Griffiths, S. G., Lovely, J. A. and Lynch, W., 1997. PCR and probe-PCR assays to monitor broodstock Atlantic Salmon (Salmo salar L.) ovarian fluid and kidney tissue for presence of DNA of the fish pathogen Renibacterium salmoninarum. Journal of Clinical Microbiology, 35, 1322–1326.

 

Michel, C., Nougaryede, P., Eldar, A., Sochon, A. and de Kinkelin, P., 1997. Vagococcus salmoninarum, a bacterium of pathological significance in rainbow trout (Onchorynchus mykiss) farming. Diseases of Aquatic Organisms, 30, 199–208.

 

Nomoto, R., Munasinghe, L. I., Jin, D-H., Shimahara, Y., Yasuda, H., Nakamura, A., Misawa, N., Itami, T., Yoshida, T., 2004. Lancefied group C Streptococcus dysgalactiae infection responsible for fish mortalities in Japan. Journal of Fish Disease, 27, 679-686.

 

Palacios, M. A., Zamora, M. J., Vasquez, J., Zamora, E., Durano, A., 1993. Streptococcosis in rainbowtrout(Oncorhynchus mykiss) in Spain. Boll Soc It Patol Ittica, 13, 11-16.

 

Pereira, F., Ravelo, C., Toranzo, A. E. and Romalde, J. L., 2004.  Lactococcus garvieae, an emerging pathogen for the Portuguese troutculture. Bulletin European Association Fish  Pathology , 24, 274–279.

 

Ravelo, C., Magarin, B., Lopez-Romalde, S., Toranzo, A. E., Romalde, J. L., 2003. Molecular fingerprinting of fish-pathogenic Lactococcus garvieae strains by random amplified polymorphic DNA analysis. Journal of Clinical Microbiology, 41, 751-756.

Sharifiyazdi, H., Akhlaghi, M., Tabatabaei, M. and Mostafavi Zadeh, S. M., 2010.  Isolation and characterization of Lactococcus garvieae from diseased rainbow trout (Oncorhynchus mykiss,

Walbaum) cultured in Iran. Iranian Journal of Veterinary Research, Shiraz University, 11, 342-350.

 

Soltani, M., Nikbakht, G. H., Ebrahimzadeh, H. A. and Ahmadzadeh, N., 2008. Epizootic outbreaks of Lactococcus garvieae in farmed rainbow trout (Oncorhynchus mykiss) in Iran. Bulletin of European Association of Fish Pathologists, 28, 209-214.

 

Vendrell, D., Luis Balcazar, J., Ruiz-Zarznela, I., de Blas, I., Girones, O. and Luis Muzquiz, J., 2006. Lactococcus garvieae in fish A review. Coparative Immunology. Microbiology and Infection Disease, 29, 177-198.

Vendrell, D., Luis Balcazar, J., Ruiz-Zarauela, I., de Blas, I., Girones, O., Luis Muzquiz, J., 2007. Safety and efficacy of an inctivated vaccine against Lactococcus garvieae in rainbow trout(Oncorhynchus mykiss). Preventive Veterinary Medicine, 80, 222-229.

Williams, A. M., Freyer, J. L. and Collins, M. D., 1990. Lactococcus piscium sp. nov., a new Lactococcus species from salmonid fish. FEMS Microbiol.Lett, 68,109–114.

 

Zlotkin, A., Eldar, A., Ghitting, C. and Bercovior, H., 1998. Identification of Lactococcus garvieae by PCR. Journal of Clinical Microbiology, 36, 983-985.

 

 

 

 



[1]- Trice EDTA buffer

[2]- Primary Denaturation

[3] - Secondary Denaturation

[4] - Annealing

[5] - Extension